Skip to main content

Table 1 Primer sequences used for amplification of bovine theca cell transcripts

From: Differentiation-specific action of orphan nuclear receptor NR5A1 (SF-1): transcriptional regulation in luteinizing bovine theca cells

Transcript 5' Primer 3' Primer Product size
bovine RPS27A CTGGCAAGCAACTGGAAGAT TCTTTTCTTAGCGCCACCAC 104 bp
bovine CYP11A1 ACTTTCGCCACATCGAGAAC CACGTCTTCAGGGTGAATGAT 98 bp
bovine STAR CTCAAGGACCAAACTCAC ATTGGCAAAATCCACCTG 106 bp
bovine INSL3 CGCTGGTCTTCCGAGGAG CCCATGGAGGAGATGTTGTC 90 bp