Skip to main content

Table 1 Primer sequences used for PCR of cDNAs

From: Effects of nerve growth factor (NGF) on blood vessels area and expression of the angiogenic factors VEGF and TGFbeta1 in the rat ovary

Gene Forward and reverse primers (5'– 3') PCR product size (bp) Reference
VEGF F: GCCAGCACATAGGAGAGATGAG
R: ACCGCCTTGGCTTGTCAC
234, 102 Adapted from [45]
TGFβ1 F: AAGTGGATCCACGAGCCCAA
R: GCTGCACTTGCAGGAGCGCA
246 [46]
Cyclophilin F: CTTTGCAGACGCCGCTGTCTCTTTTCGCCG
R: GCATTTGCCATGGACAAGATGCCAGGA
350 [47]