Skip to main content

Table 4 Oligonucleotide primers used for real-time PCR in experiment 3.

From: Tissue- and hormone- dependent progesterone receptor distribution in the rat uterus

Gene Accession No. Primers Position
PRAB NM_022847 Forward CAGGCCGCGGTGCTCAA bp 1546–1572
   Reverse GTGGGCTCTGGCTGGCTTCT bp 1636–1617
    Product 91 bp
PRB U06637 Forward CAGACCAACCTGCAACCAGAA bp 1471–1491
   Reverse AGTCCTCACCAAAACCCTGGG bp 1592–1572
    Product 122 bp
RPLP0 NM_001002 Forward GGCGACCTGGAAGTCCAACT bp 195–214
   Reverse CCATCAGCACCACAGCCTTC bp 343–324
    Product 149 bp