Skip to main content

Table 1 Primers used for quantitative real-time PCR

From: Identification of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)-inducible genes in human amniotic epithelial cells

Gene Name Abbreviation   Primers
Arylsulfatase B ARSB Forward Primer GTGGTGTGATCTCGGCTCACT
   Reverse Primer CGTGGTGGTGTATGCCTGTAAT
Carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 6 CHST6 Forward Primer GAAACTGAGTCCACCACTTGAGAA
   Reverse Primer TTATTGCTCCTAAAGTCTTCGACTTG
Cytochrome P450 1A1 CYP1A1 Forward Primer AGCGGAAGTGTATCGGTGAGA
   Reverse Primer CTGAATTCCACCCGTTGCA
Cytochrome P450 1B1 CYP1B1 Forward Primer AGCAGGCTTGCCCAGTACATT
   Reverse Primer AAATAGGCTACAGCAGCCCAAA
Dehydrogenase/reductase (SDR family) member 2 DHRS2 Forward Primer TACTCATGCTAGGCTTGAGGAAGA
   Reverse Primer CACCAAGAACCCCACATGTTAA
Fucosyltransferase 2 (secretor status included) FUT2 Forward Primer CCAGTGTGCATACAGTCATGGA
   Reverse Primer CACGGTGCACTATATTCCCTAACTC
GDP-mannose 4,6-dehydratase GMDS Forward Primer GCCAAGGACTATGTGGAGGCTAT
   Reverse Primer ACAAATTCCCGGACACTATGGA
Matrix metalloproteinase 9 MMP9 Forward Primer TTCCAGTACCGAGAGAAAGCCTAT
   Reverse Primer GGTCACGTAGCCCACTTGGT
Membrane metallo-endopeptidase MME Forward Primer ATTCCTTTGGGCCTCTGCTT
   Reverse Primer TGGGAAGGCAGCATTGGA
Mitochondrial thioredoxin reductase TXNRD2 Forward Primer CTGAGGAAACTCTTATCAGAACATTACAC
   Reverse Primer GCGACGCGGTGCTACAA
Podocalyxin-like PODXL Forward Primer GCAGAGAGGGCAAGAGTAAAACTG
   Reverse Primer GAGTCATCTGTGTCCTCCATGCT
Poly (ADP-ribose) polymerase family, member 12 ZC3HDC1 Forward Primer TTCTCAGAGTCTCATGGCATCATAGT
   Reverse Primer GTCAGAACAACAGGCAGAAGTGA
Stearoyl-CoA desaturase SCD Forward Primer AGGAATGTCCACCATGAACTTGATA
   Reverse Primer CACCGCTTCTCCAATGGATT
Ubiquitin-conjugating enzyme E2E 1 (UBC4/5 homolog, yeast) UBE2E1 Forward Primer GGTGGGAAGTATTGCCACTCA
   Reverse Primer GTGAAACCCCAATTTATGTAGCGTAT
Uridine phosphorylase 1 UPP1 Forward Primer CGATTAAGAGACAGAGAATCTTGGATTA
   Reverse Primer GAAACCCCAAATCAGGCTAACA
Interleukin 12B IL12B Forward Primer GACAAGTAGTTATGGCTAAGGACATGA
   Reverse Primer AGGGATTCCAGATTTTCTTTGCA
Distal-less homeo box 2 DLX2 Forward Primer AGCCTGGACTTGGACACAGAGT
   Reverse Primer GGGTTGCTGAGGTCACTGCTA
Early growth response 1 EGR1 Forward Primer AAGCCAAGCAAACCAATGGT
   Reverse Primer ACTCTGACACATGCTCTGAGAATACTG
High mobility group AT-hook 1 HMGA1 Forward Primer GTCCCCTACTCCCTCTTCACTGT
   Reverse Primer ACCTGGACAATAAGTGACTGCATCT
Interferon regulatory factor 7 IFR7 Forward Primer GCCTGGTCCTGGTGAAGCT
   Reverse Primer GAAGCACTCGATGTCGTCATAGA
Interferon-stimulated transcription factor 3, gamma 48 kDa ISGF3G Forward Primer AAGTAGACTCATTCTTCACACGATTGAC
   Reverse Primer AGCCAGTGTGTGCGAGGATT
Myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 (MLLT10) MLLT10 Forward Primer GACCATTAAAAGCTCACCACTAGAGTTC
   Reverse Primer CTGCGGTACTGTCACATCAAAAG
N-myc (and STAT) interactor (NMI) NMI Forward Primer CGTGAAGATCAAATGAGAGACAAACT
   Reverse Primer CTCCCGGACTGTCTGTCATAGTC
Nuclear antigen Sp100 SP100 Forward Primer CAGCTGTTTTGTTGACATTCTGAA
   Reverse Primer TGGAAGAAGACTGACCTGGTACCT
Tumor necrosis factor, alpha-induced protein 3 TNFAIP3 Forward Primer GAGTAAATTGGCCTCTTTGATACACTT
   Reverse Primer AGGAGAAGCACGAAACATCGAT
v-maf musculoaponeurotic fibrosarcoma oncogene homolog F (avian) MAFF Forward Primer CCAGAAGGCAGAGGTTGTAGTGA
   Reverse Primer AGGAGCCGGGCAATATTTTTTA
GABA-B receptor GPR51 Forward Primer TGTGCGTCTGTAACCCTTTGTG
   Reverse Primer AATGGGTGAACCTACAGTATCAGTAAGA
Interferon, alpha 1 IFNA1 Forward Primer TGATGAATGCGGACTCCATCT
   Reverse Primer GACAACCTCCCAGGCACAAG
Signal transducer and activator of transcription 1 STAT1 Forward Primer TTGAGTGGATGATGTTTCGTGAA
   Reverse Primer AGAACCTTGTCAAACCCATCTCTT
Solute carrier family 2 (facilitated glucose transporter), member 1 SLC2A1 Forward Primer ACCACTGCAACGGCTTAGACTT
   Reverse Primer TGGGTAACAGGGATCAAACAGAT
Solute carrier family 2 (facilitated glucose transporter), member 3 SLC2A3 Forward Primer TTGCTCTGGGTGGAAGTACGTT
   Reverse Primer ACCAAGAAGGGAAAGGGAGACT
Amphiregulin AREG Forward Primer GCTGCCTTTATGTCTGCTGTGA
   Reverse Primer CGTTCCTCAGCTTCTCCTTCA
Caveolin 2 CAV2 Forward Primer CTCATATCCTTTTGAAGGTAGTTGCA
   Reverse Primer GGTGATGCTTTAAGGTAATGATTATGC
DnaJ (Hsp40) homolog, subfamily C, member 3 DNALC3 Forward Primer AAGAAGTTTGACGACGGAGAAGA
   Reverse Primer TTGAACCCTTGCCATGAGTTC
Epiregulin EREG Forward Primer CAATGTAACTCCACTGTTCTCCTGAA
   Reverse Primer CTGGTGGTGATTGAATTTAGTCTCA
Epithelial membrane protein 1 EMP1 Forward Primer AACTCTTGTGGTACCTAGTCAGATGGTA
   Reverse Primer GCAAAGCAATGCCTGCTTAAC
FLJ20035 FLJ20035 Forward Primer TAGTCCAGGATAACAGGATGAATGAA
   Reverse Primer ACATAGCTCACGCAAGGAAACA
Insulin induced gene 1 INSIG1 Forward Primer AAGCTTAGAGGAACTTGCCTGTGA
   Reverse Primer TACTCCAAGACATTTCCCTCAAAAC
Integrin, alpha 10 ITGA10 Forward Primer AGTAAAGGCAGTTGGATTCTCATAGAC
   Reverse Primer GAGCTGCACTCTGGAGACCAAT
Integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) ITGA2 Forward Primer AGATGATTTGGTCAGATTGGGATAAG
   Reverse Primer TGGGTGGTGTTTCTCAAAGTGT
Interferon induced transmembrane protein 1 IFITM1 Forward Primer TCCCTGTTCAACACCCTCTTCT
   Reverse Primer GTCACGTCGCCAACCATCTT
Interferon, alpha-inducible protein G1P2 Forward Primer CCTGCTGGTGGTGGACAAAT
   Reverse Primer CCGCTCACTTGCTGCTTCA
Interferon, alpha-inducible protein 27 IFI27 Forward Primer TGGCCAGGATTGCTACAGTTG
   Reverse Primer TATGGAGGACGAGGCGATTC
Interferon-induced protein with tetratricopeptide repeats 1 IFIT1 Forward Primer GAAACTTCGGAGAAAGGCATTAGA
   Reverse Primer GCTCATAGTACTCCAGGGCTTCAT
Interferon-induced protein with tetratricopeptide repeats 2 IFIT2 Forward Primer CTTGGAACGATTGAGATTTTCTAGGT
   Reverse Primer CCCAGAGTGTGGCTGATGCT
Keratin 6A KRT6A Forward Primer TTCAGAACAACTTCCACTTACTTTCC
   Reverse Primer GTCACTTGTGCTTTCATGGATACTG
Low density lipoprotein receptor-related protein 3 LRP3 Forward Primer CCCATCCTATGGTCAGCTCATC
   Reverse Primer CGTGCCGACGCATCTGT
Presenilin 2 (Alzheimer disease 4) PSEN2 Forward Primer CACAGCAGGTTTATCCAGATGAAC
   Reverse Primer CACTCCCGAGCACACTCTTTG
Ras-related associated with diabetes RRAD Forward Primer TTGAGACATCAGCGGCATTG
   Reverse Primer CGTCGTGCGTTGGCTTCT
Serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 2 SERPINB2 Forward Primer GTGAATGAGGAGGGCACTGAAG
   Reverse Primer AGAAAAGGATGATCTGCCACAAAC
Small proline-rich protein 3 SPRR3 Forward Primer CCATGTCCTTCAACGGTCACT
   Reverse Primer AGCATCTGGTGGTTGGCTTCT
Tripartite motif-containing 14 TRIM14 Forward Primer GCAGAGACAGAGCTAGACTGTAAAGGT
   Reverse Primer CCTGGTCACACAATTGATATGGA
Tumor necrosis factor TNF Forward Primer GAATGTGTGGCCTGCACAGT
   Reverse Primer CCAGATGTCAGGGATCAAAGC
Chromosome 10 open reading frame 116 C10orf116 Forward Primer ACAGCCTGGCCCTGATCTC
   Reverse Primer GCTTGCGAGGAATCATGAAGT
Pleckstrin homology-like domain, family A, member 1 PHLDA1 Forward Primer ACGAGCACATTTCTATTGTCTTCACT
   Reverse Primer TCGCAAGTTTTCAGTAGGGTGAT