Skip to main content

Table 1 GenBank reference numbers used for primer design, primer sequences, annealing temperatures, and GenBank accession numbers for the resulting ovine sequence for the various genes amplified.

From: The role of transforming growth factor-beta (TGF-beta) during ovarian follicular development in sheep

Gene Reference: (Genbank #) Forward Primer (5' to 3') Reverse Primer (5' to 3') Annealing temperature Genbank # (resulting sequence)
TGF-β1 NM_011577 ggaattcatgccgccctcggggctgcgg (EcoR I site and bases 867–888) ggtctagatcagctgcacttgcaggagcg (Xba I site and bases 2040–2020) 63°C ND
TGF-β2 M19154 ggaattcatgcactactgtgtgctgagc (EcoR I site and bases 468–488) ggtctagagctgcatttrcaagacttkac (Xba I site and bases 1794–1773) 64°C AY656797
TGF-β3 J03241 ggaattcgcaaagggctctggtggtcctgg (EcoR I site and bases 277–299) ggtctagaccagttctcctccaagttgcgg (Xba I site and bases 1206–1186) 62°C AY656798
TGFβRI U97485 cacagatgggctttgctttg (bases 180–199) ccttgggtaccaactatctc (bases 1007–988) 50°C AY656799
TGFβRII S69114 gtcctgtggacgcgcat (bases 80–97) aggagcacatgaagaaagtc (bases 449–430)* 50°C AY656800
TGFβRII (for PCR) various gccaacaacatcaaccac gggtcrtggtcccagca 53°C AY751461
TGFβRII (internal for PCR) AY751461 tcgccgaggtctacaagg atgccctggtggttgagc 55°C N/A
  1. * Sequence is based on the corresponding ovine sequence obtained from an ovine est clone.
  2. ND, the complete sequence of the clone was not determined, as the ovine TGF-β1 sequence is known. The clone was sequenced from both ends and resulting sequence compared to the known ovine TGF-β1 sequence to confirm identity of the isolated cDNA.
  3. N/A as the sequence overlaps that of AY751461.
Back to article page

Reproductive Biology and Endocrinology

ISSN: 1477-7827

Contact us