Table 1 GenBank reference numbers used for primer design, primer sequences, annealing temperatures, and GenBank accession numbers for the resulting ovine sequence for the various genes amplified.
Gene | Reference: (Genbank #) | Forward Primer (5' to 3') | Reverse Primer (5' to 3') | Annealing temperature | Genbank # (resulting sequence) |
|---|---|---|---|---|---|
TGF-β1 | NM_011577 | ggaattcatgccgccctcggggctgcgg (EcoR I site and bases 867–888) | ggtctagatcagctgcacttgcaggagcg (Xba I site and bases 2040–2020) | 63°C | ND |
TGF-β2 | M19154 | ggaattcatgcactactgtgtgctgagc (EcoR I site and bases 468–488) | ggtctagagctgcatttrcaagacttkac (Xba I site and bases 1794–1773) | 64°C | AY656797 |
TGF-β3 | J03241 | ggaattcgcaaagggctctggtggtcctgg (EcoR I site and bases 277–299) | ggtctagaccagttctcctccaagttgcgg (Xba I site and bases 1206–1186) | 62°C | AY656798 |
TGFβRI | U97485 | cacagatgggctttgctttg (bases 180–199) | ccttgggtaccaactatctc (bases 1007–988) | 50°C | AY656799 |
TGFβRII | S69114 | gtcctgtggacgcgcat (bases 80–97) | aggagcacatgaagaaagtc (bases 449–430)* | 50°C | AY656800 |
TGFβRII (for PCR) | various | gccaacaacatcaaccac | gggtcrtggtcccagca | 53°C | AY751461 |
TGFβRII (internal for PCR) | AY751461 | tcgccgaggtctacaagg | atgccctggtggttgagc | 55°C | N/A |