Skip to main content

Advertisement

Table 2 Amplicon-specific primer and probe sequences

From: Analysis of Maxi-K alpha subunit splice variants in human myometrium

Primer name Primer/Probe sequence (5' – 3') Primer/Probe Tm (°C)
Conserved F TGCACAAAGAGGTATGTCATCAC 58.9
Conserved R GTTTGCTGTGGATGGGATGGA 59.8
Conserved Probe 6F * -CCCACTCGTCGCAGTCCTCCAGCAAGAAGA XT♣ 68.9
132 bp splice F ACGCTCAAGTACCTGTGGACCGT 64.2
132 bp splice R TGTGGTTCCAGTTGAGTCACCA 60.3
132 bp Probe 6F-CTCCAGGGTGGAGTGATTGGCTGTATGTT XTCAC 71.5
87 bp splice F CATCGCAAGTGATGCCAAAGAA 58.4
87 bp splice R TCAACTGGCTCGGTCACAAGC 61.8
87 bp Probe 6F-TTGCAGCTAGATCACGCTATTCCAAAGATCCA XT 68.9
β-actin F CAACTCCATCATGAAGTGTGAC 55.8
β-actin nested R GTCAAGAAAGGGTGTAACGCA 55.4
β-actin Probe 6F-TGGCACCCAGCACAATGAAGATCAAATCA XT 70.3
  1. * 6F = FAM reporter dye; ♣ XT = TAMRA quencher dye