Skip to main content

Advertisement

Table 1 Primer Pairs

From: Analysis of Maxi-K alpha subunit splice variants in human myometrium

Primer name Primer sequence (5' – 3') Primer Tm (°C)
Maxi 0F CGGAGGCAGCAGTCTTAG 58.2
Maxi 0R AAGAAAGTCACCATGGAGGAG 57.9
Maxi 1F CTCCTCCATGGTGACTTTCTT 57.9
Maxi 1R TTACAAGTGCACCGATGCTG 57.3
Maxi 2F GGAAACCGCAAGAAATAC 53.1
Maxi 2R ACCTCATGGAGAAGAGGTTG 57.3
Maxi 3F GGTCTGTCCTTCCCTACTGT 59.4
Maxi 3R CAAAGATGCAGACCACGACA 57.3
Maxi 4F GTGCCAGCAACTTTCATTAC 55.3
Maxi 4R TCAGGGTCATCATCATCGTC 57.3
Maxi 5F ACAGCATTTGCCGTCAGTG 56.7
Maxi 5R GGTCCGTCTGCTTATTTGCT 57.3
β-actin F CAACTCCATCATGAAGTGTGAC 55.8
β-actin R GCCATGCCAATCTCATCTTG 59.3