Skip to main content

Table 1 Gene specific amplification primers

From: Expression of connexins in human preimplantation embryos in vitro

Target Gene Primer pair sequences (5' – 3') Accession number Position in sequence Fragment Size (bp) Annealing Temp (\r C)
β actin GACAGCAGTCGGTTGGACC M10277 3163–3179 387 62
  CAGGTAAGCCCTGGCTGC   3549–3532   
Cx26 (a) GTTTAACGCATTGCCCAGTT M86849 874–893 174 62
  TGTGGCATCTGGAGTTTCAC   1047–1028   
Cx26 (b) AGGCCTGTCCAACACATCTC   1760–1779 244 64
  AGGGGGTAAGCCAAACAAAC   2003–1984   
Cx31 TGCAGTGGAGAGGAGGTCTT BC012918 1454–1473 184 66
  CAGTTGTGGGGAGGAAGATG   1637–1618   
Cx32 (a) GGGTACAAGAGATGGGATGC BC039198 1200–1219 202 64
  GCCAGCAAGCACTATTCCTC   1401–1382   
Cx32 (b) CCCTGGTTTTCTGGAGTCAC NM_000166 1273–1292 206 62
  CCCTGCTCCAACTTATCTGC   1478–1459   
Cx40 (a) TTGCAACCTTTCCTTCTGCT BC013313 1878–1897 180 64
  GTGAACAGCCAAGGGAGAAA   2057–2038   
Cx40 (b) CCCTGCTAGGGAGTCACTGT   1929–1948 201 62
  CTGGTCAGGGTTCGAGAGAG   2129–2110   
Cx43 CTGACATGCATGCAAGAAGAA BC026329 2802–2782 217 64
  TCTTTTGGAGTGACCAGCAA   2586–2605   
Cx45 AGATCAGGATGGCTCAGGAA U03493 1022–1041 155 64
  GTTCTTCCCATCCCCTGATT   1176–1157