Skip to main content

Table 1 Primers used in this study

From: Molecular cloning and expression analysis of the Synaptotagmin-1 gene in the hypothalamus and pituitary of Huoyan goose during different stages of the egg-laying cycle

Primers purpose Primer name Primer sequence (5′-3’)
RT-PCR Syt1-F AACCCTGTTTTCAATGAGCAA
  Syt1-R CACTATGTGGGCAAATGCAG
3’-RACE Syt1-GSP3 GGGCTACAACAGCACTGGAGCGGAG
  Syt1-NGSP3 CTTGCAGCCCGAGGAGGAGGTAGAT
5’-RACE Syt1-GSP5 CCGTGTTCATCGCAACCTTA
  Syt1-NGSP5 TTCCACCCAGCTCGGAGTAT
RACE UPM-Long CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT
  UPM-Short CTAATACGACTCACTATAGGGC
Real-time PCR Syt1-S TATGACAAGATTGGCAAGAAC
  Syt1-A GGCATCTACCTCCTCCTC
Internal control 18S rRNA-S CGGACAGGATTGACAGATTGAG
  18S rRNA-A GCCAGAGTCTCGTTCGTTAT