Skip to main content

Table 3 List of genes that were not differentially expressed in fetal liver at e18.5

From: Critical periods of increased fetal vulnerability to a maternal high fat diet

Gene name Gene symbol Gene sequence (Forward and Reverse) p value
Glycogen-synthase kinase b GSK3b CGGGACCCAAATGTCAAACT NS
TCCGAGCATGTGGAGGGATA
Glucose transporter 2 GLUT2 GTGTGCAGCAGCCTGTGT NS
CAGTGAAGGCCGTGTTGAC
Insulin Receptor INSR CCTGAAAAGTCACCTCCGTTCT NS
TTCAAGTATGCCATGCCATCA
Hydroxysteroid (11-beta) dehydrogenase 1 HSD11B1 GGGAAATGACCCAGCCTATG NS
CGTGGAAAAGAACCCATCCA
Hydroxysteroid (11-beta) dehydrogenase 2 HSD11B2 CGGGCAGTTCCTGAATTCAC NS
GCATCGATGATGGCATCTACA
Sterol regulatory element binding transcription factor 1 SREBF1 CCAGAGGGTGAGCCTGACAA NS
AGCCTCTGCAATTTCCAGATCT
Sterol regulatory element binding transcription factor 2 SREBF2 CACCAGCTGCACATCACAG NS
ACTCGGCCAGGTTCACAG
  1. N = 4-6/diet group; NS = not significant.