Skip to main content

Table 2 Sequence of primers used in this study

From: The term basal plate of the human placenta as a source of functional extravillous trophoblast cells

Gene Sequence Number of cycles Annealing (°C) Size
18S Forward: 5′ GTAACCCGTTGAACCCCATT3′ 20 56 115 bp
Reverse: 5′ CCATCCAATCGGTAGCG 3′
GADPH Forward: 5′CTGTTGCTGTAGCCAAATTCGT3′ 28 60 102 bp
Reverser: 5′ACCCACTCCTCCACCTTTGA3′
MMP-2 Forward: 5 AGCTCCCGGAAAAGATTGATG3′ 35 60 101 bp
Reverse: 5′ CAGGGTGCTGGCTGAGTAGAT3′
MMP-9 Forward: 5′ GAGGTGGACCGGATGTTCC 3′ 35 54 106 bp
Reverse: 5′ AACTCACGCGCCAGTAGAAG 3′