Skip to main content

Advertisement

Table 2 Primer sequences used in quantitative real-time PCR

From: Increased expression of the pluripotency markers sex-determining region Y-box 2 and Nanog homeobox in ovarian endometriosis

Gene Sense primer 5′ –3′ Antisense primer 5′ –3′ Genbank accession NM
GAPDH TGCACCACCAACTGCTTAGC GGCATGGACTGTGGTGATGAG NM_002046
SOX2 TACAGCATGTCCTACTCGCAG GAGGAAGAGGTAACCACAGGG NM_003106
NANOG AAGGTCCCGGTCAAGAAACAG CTTCTGCGTCACACCATTGC NM_024865
OCT4 GCAGCGACTATGCACAACGA CCAGAGTGGTGACGGAGACA NM_002701