Skip to main content

Table 1 Primers used in the real-time quantitative PCR of genes in chicken samples

From: Leptin receptor signaling inhibits ovarian follicle development and egg laying in chicken hens

Gene Accession number Primer sequences (5′-3′) Length(bp)
β-actin L08165 upstream: CCGAGAGAGAAATTGTGCGTGAC 166
downstream: TCGGGGCACCTGAACCTCTC
FSHβ AY029204 upstream: GGCTGCGGTGACCATCCTGAATC 101
downstream: GGCCCCAGTCCTCTCACAGTGCA
GnRH-I JN609557 upstream:TGTCCTCCTGTTCACCGCATCTG, 222
downstream: TCGATCAGGCTTGCCATGGTTTC
LHβ HQ872606 upstream:GGGGGGAGCGCAGGTGTTG 220
downstream: CCCGCAGGCCGTGGTGGT
AgRP AB029443 upstream: TCCCCTCGCCGCTGTGTC 137
downstream: CATGGGAAGGTGGTGCTGATC
NPY NM_205473 upstream: GGAAAGAGATCAAGCCCAGAGAC 193
downstream: ATGCACTGGGAATGACGCTATG
orexin AB056748 upstream: CGCTGGGCAAGAGGAAGAG 117
downstream: GGCGCTCCTCACGTTTGC
MC4R AY545056 upstream: GCCAAGAACAAGAACCTCCATT 150
downstream: TATGGTAAAGCTCTGTGCGTCTG
POMC NM_001031098 upstream: GGCCGAGGCACCCGTGTAC 141
downstream: GCGGGGTGGTGGGGTGAC
LEPR NM_204323 upstream: TTTGCTGTTGGGCTTTCTTCAC 148
downstream: AACCAGACCGGCTCCGTACA
FSHR NM_205079 upstream: TCCCACCAATGCCACAGAAC 155
downstream: TGGGAAGGCTGGAAAACACA
LHR AB009283 upstream: GGGCATGAGCAACGAATCG 124
downstream: CCGCCTGAGGTTTTTGTTGTC
IGF-I NM_001004384 upstream: TGCTGCTTTTGTGATTTCTTGAA 138
downstream: AACCAGCTCAGCACCACACAGT
fas NM_001199487 upstream: TTCCCACACACACTGCACATAA 153
downstream: CACACCGAGAAGAATTGCAGTAA
caspase3 NM_204725 upstream: CCACGCTCAGGGGAAGATGTAT 173
downstream: CGGTATCTCGGTGGAAGTTCTTA  
bcl2 NM_205339 upstream: CGCCGCTACCAGAGGGACTTC 192
downstream: CGCCGCCGAACTCGAAGAAG
StAR NM_204686 upstream: GCCGGACGTGGGTAAGGTGT 184
downstream: CGCCGTCTCGTGGGTGATC
CYP19A1 NM_001001761 upstream: TGCCAGTTGCCACAGTGCCTATC 112
downstream: GGCCCAATTCCCATGCAGTATC
CYP17A1 NM_001001756 upstream: CGGGCAGCTTTCAGGCATG 189
downstream: TGGCCATGATGTTGTGCACGTT
PPAR AB045597 upstream: GCTCCAGGATTGCCAAAGTG 137
   downstream: TCCCCACACACACGACATTCA