Skip to main content

Table 1 Primer sequences used in the qPCR experiments

From: High-fat diet decreases the expression of Kiss1 mRNA and kisspeptin in the ovary, and increases ovulatory dysfunction in postpubertal female rats

Gene name Primer sequences (5’–3’) Expected size(bp) Accession Number (GenBank)
Kiss1 Forward TGCTGCTTCTCCTCTGTGTGG 110 NM_181692.1
  Reverse ATTAACGAGTTCCTGGGGTCC   
Kiss1r Forward CTTTCCTTCTGTGCTGCGTA 102 NM_023992.1
  Reverse CCTGCTGGATGTAGTTGACG   
GDF9 Forward GAGGAAACACAGGTGGATTGAGATG 174 NM_021672.1
  Reverse AGATACAAGATGAGCGAGGGCG   
BMP15 Forward GCTAAAATGGTGAGGCTGATAAA 180 NM_021670.1
  Reverse ATGGCAGGAGAGATGGTAATG   
FSHR Forward CTACACATTGACAGCCATCACCCTA 121 NM_199237.1
  Reverse GGCAAAAGTCCAGCCCAATACC   
PTGS2 Forward TCTCCAACCTCTCCTACTACACCA 139 NM_017232.3
  Reverse ATGAACTCTCTCCTCAGAAGAACCT   
HPRT1 Forward CCCCAAAATGGTTAAGGTTGC 175 NM_012583.2
  Reverse TCCACTTTCGCTGATGACACAA