Skip to main content

Table 1 Primers sequences used for PCR amplification and conditions

From: Differential expression of pluripotent and germ cell markers in ovarian surface epithelium according to age in female mice

Gene Sequence Tm (°C) Cycles Product size (bp)
Oct-4 FW: AGCACGAGTGGAAAGCAACTC 57 38 497
RV: CAAGCTGATTGGCGATGTGAG
Sox-2 FW: ACGCTCATGAAGAAGGATAA 58 42 330
RV: GTAGGACATGCTGTAGGTGG
Nanog FW: TACCTCAGCCTCCAGCAGAT 56 42 460
RV: CACCTCCAA ATCACTGGCAG
c-Kit FW: GTCATTGTTGGCTACGAGAT 57 28 142
RV: AACACGAGGTCATCCACTAT
GDF-9 FW: TTGCTGTTGCCTGTAGATGG 57 28 204
RV: GAAGAGCCGGACGGTATTGT
VASA FW: GCTCAA ACAGGGTCTGGGAAG 58 35 145
RW: GGTTGATCAGTTCTCGAGTTC
GAPDH FW: ACCACAGTCCATGCCATCAC 57 25 452
RV: TCCACCACCCTGTTGCTGTA