Skip to main content

Table 1 Primers used for qRT-PCR

From: SET protein up-regulated testosterone production in the cultured preantral follicles

Gene GeneBank ACC Primer Sequence(5-3) Size
SET NM_023871 Forward CTTCAAAGTCCACCGAAATCAAATG 146 bp
(mouse)   Reverse ACCTGCGTCAGAATGGTCAGTAAAC  
GAPDH NM_008084 Forward AGGTTGTCTCCTGCGACTTCA 187 bp
(mouse)   Reverse GGGTGGTCCAGGGTTTCTTACT  
StAR http://NM_011485.4 Forward CCACCTGCATGGTGCTTCA 142 bp
(mouse)   Reverse TTGGCGAACTCTATCTGGGTCTG  
CYP11A1 NM_019779 Forward GGCACTTTGGAGTCAGTTTACAT 186 bp
(mouse)   Reverse GTTTAGGACGATTCGGTCTTTCTT  
CYP17A1 http://NM_007809.3 Forward TCTGGGCACTGCATCACG 124 bp
(mouse)   Reverse GCTCCGAAGGGCAAATAACT  
HSD3B2 http://NM_153193.2 Forward CTGCGATCCAGAAACCTTCC 224 bp
(mouse)   Reverse TCTTCCTCTTGCACCAACAAC