Skip to main content

Table 1 Primers used in this study

From: Cloning and characterization of a novel oocyte-specific gene encoding an F-Box protein in rainbow trout (Oncorhynchus mykiss)

Primer name Primer sequence 5′-3′ Application
Fbxoo-F851 GACATCAGATACCTGGCCTCA RT-PCR
Fbxoo-R1374 TGGGAGATCTTGGTGTCAAAC RT-PCR
Fbxoo-SP1-50 GCGAGAACTGTCCCTGCAAC 5′RACE
Fbxoo-SP2-105 CGTCCATGTGTGTCCTCACTT 5′RACE
Fbxoo-SP3-136 CGTCACTTAAGTCTAGTATCCC 5′RACE
Fbxoo-F1436 CTCTACCTGGAGGCAGTGAAA Real time PCR
Fbxoo-R1567 GAGTGCTCAATCTGCGTTAGC Real time PCR
HistoneH2A-F TCCCCAAGAAGACTGAGAAGG Real time PCR (control)
HistoneH2A-R TTTGTTGAGCTAGGTGGTTGG Real time PCR (control)
Fbxoo-Y2H-F ATGTCGACTTATGGCACTTCGT Yeast two hybridization
Fbxoo-Y2H-R ATATGTCGACCTAGCTGAC Yeast two hybridization