Skip to main content

Table 1 Primers used for the full-length cloning and expression of the porcine MAP1LC3A gene

From: Molecular cloning and expression analyses of porcine MAP1LC3A in the granulosa cells of normal and miniature pig

Primer name Sequence Size
cDNA cloning primers
GeneRacer 3 -primer 5 GCTGTCAACGATACGCTACGTAACG 3  
GeneRacer 3 -nested primer 5 CGCTACGTAACGGCATGACAGTG 3  
GeneRacer 5 -primer 5 CGACTGGAGCACGAGGACACTGA 3  
GeneRacer 5 -nested primer 5 GGACACTGACATGGACTGAAGGAGTA 3  
5 RACE-Rv primer 1 5 TGTCCAGGACTGGCAGCTGCTTCT 3  
5 RACE-Rv primer 2 5 CCAACTCGCTCATGTTGACATGGT 3  
3 RACE-Fw primer 5 ATCGAGCGCTACAAGGGTGAGAAGC 3  
Gene expression primers
Porcine GAPDH Fw 5 CCCGTTCGACAGACAGCCGTG 3 238
Porcine GAPDH Rv 5 CCGCCTTGACTGTGCCGTGG 3
Porcine MAP1LC3A Fw 5 AGAAGCAGCTGCCAGTCCTGGACA 3 687
Porcine MAP1LC3A Fw 5 CAGGCAGGCCTGAGCAATCTTTATT 3
Porcine ATG5 Fw 5 AGAGAAGTCTGTCCTTCCGCAGTCG 3 241
Porcine ATG5 Rv 5 AAGCAGAAGGGTGACATGCTCTGGT 3