Skip to main content

Table 1 Primers used in real-time quantitative PCR of genes in goose samples

From: The characteristics of oviposition and hormonal and gene regulation of ovarian follicle development in Magang geese

Gene name Accession number Prime sequences (5′ to 3′) Annealing temperature (°C) PCR product (bp)
LHR U31987.1 upstream: CTCTGTGATAACTTGCGTAT 52.8 119
   downstream: AAGGCATGACTGTGGAT 52.8 279
FSHR NM_205079.1 upstream: CAACCTTCCCAAACTAC 52.8 327
downstream: ATTTCCTGAATCCCATT
ß-Glycan M77809.1 upstream: GTGAACTTCCCAATAGCA
downstream: AGTGTCCAGACCGTAGAAC
Activin IIRα D31899.1 upstream: ACTGACTTCCTCAAGGCTAA 52.8 131
   downstream: GAGATGGCGGGTTTATGT 55.8 114
Inhibin α NM_001031257.1 upstream: GGGCTGGAAGAGGTAGGTGAAGAT 55.8 113
downstream: GGAGGACACGTCGCAGGTGAT
Inhibin ßA NM_205206.1 upstream: CAGTGGACACCCGAAAGA
downstream: GCACAGGTCACAGGCAAT
Activin IR NM_204560.1 upstream: TGCCTGGATGGTTTCGTC 55.8 189
downstream: GCCATTTCTCATCGGGACT
Activin IIRβ NM_204317.1 upstream: ATTTACTACAACGCCAACT 55.8 143
downstream: CAGCCTTTCTTCACCAG   
β-Actin L08165.1 upstream: GAGAGAAATTGTGCGTGA 55.8/52.5 195
   downstream: TCCATACCCAAGAAAGAT