Skip to main content

Table 2 Primer sequences for quantitative RT-PCR

From: Differential neutrophil gene expression in early bovine pregnancy

Gene Accession no. Forward primer Reverse primer
ISG15 NM_174366 GCAGACCAGTTCTGGCTGTCT CCAGCGGGTGCTCATCAT
MX1 NM_173940 GAGGTGGACCCCCAAGGA CCACCAGATCGGGCTTTGT
MX2 NM_173941 GGGCAGCGGAATCATCAC CTCCCGCTTTGTCAGTTTCAG
OAS1 NM_178108 CCAAGTCAAACAAGCCATCGA CACATCGGAAACACCTCTCCTT