Skip to main content

Table 1 Primer sequences

From: Expression analysis of MND1/GAJ, SPATA22, GAPDHS and ACR genes in testicular biopsies from non-obstructive azoospermia (NOA) patients

Gene Accession no. Forward primer sequence (5' - > 3') Reverse primer sequence (5' - > 3') PCR product size, bp Reference
MND1 NM_032117.3 GTTGATGATGGTATGGTTGACTGTG CCCTCAGACAACTGAGATTCCAGA 125 5
SPATA22 NM_032598.4 TGGCGTGAACATGCACAGAA TTCGAATAATATGGGCCAGGTGTAA 89 5
GAPDHS NM_014364.4 AAGGGGCCCATGGCTGGCATC GCATCGAAGATGGACGAGTGGGT 92 this MS
ACR NM_001097.2 TTGCTAAAGATAACGCCACGTGTGA ATTTTTGCCGACGAAGCAGTGAGC 230 this MS
GAPDH NM_002046.4 GAAGGTGAAGGTCGGAGTCAAC CAGAGTTAAAAGCAGCCCTGGT 71 11
PPIA NM_021130.3 CCCACCGTGTTCTTCGACATT GGACCCGTATGCTTTAGGATGA 275 this MS