Skip to main content

Table 1 Primers used in real-time qPCR analysis

From: Follicle-stimulating hormone responsiveness in antral follicles from aryl hydrocarbon receptor knockout mice

Gene name Gene symbol Primer sequence (5’-3’) Annealing temperature (°C) Band (bp) GenBank accession no.
Beta actin Actb F: ctggcaccacaccttctac 55.0 238 NM_007393
R: gggcacagtgtgggtgac
Cytochrome P450, family 11, subfamily A, polypeptide 1 Cyp11a1 F: agatcccttcccctggcgacaatg 60.0 192 NM_019779
R: cgcatgagaagagtatcgacgcatc
Cytochrome P450, family 17, subfamily A, polypeptide 1 Cyp17a1 F: ccaggacccaagtgtgttct 56.0 250 NM_007809
R: cctgatacgaagcacttctcg
Cytochrome P450, family 19, subfamily A, polypeptide 1 Cyp19a1 F: catggtcccggaaactgtga 56.0 187 NM_007810
R: gtagtagttgcaggcacttc
Follicle stimulating hormone receptor Fshr F: gcagatgtgttctccaacctacc 61.0 172 NM_013523
R: ggagagactggatcttgtgaaagg
Hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1 Hsd3b1 F: caggagaaagaactgcaggaggtc 59.5 280 NM_008293
R: gcacacttgcttgaacacaggc
Steroidogenic acute regulatory protein Star F: cagggagaggtggctatgca 57.0 262 NM_011485
R: ccgtgtcttttccaatcctctg
Inhibin, beta-a Inhba F: tcacctttgccgagtcaggc 59.0 97 NM_008380
R: ccacacttctgcacgctcca
  1. F, forward; R, reverse.