Skip to main content

Table 1 Description of primers used for quantitative real-time PCR

From: Follicular expression of follicle stimulating hormone receptor variants in the ewe

Target Accession no. Primer name Sequence 5’ to 3’ Length Amplicon
β -Actin NM_001009784 oBeta-Actin For GTCATCACCATCGGCAATGA 20 88
oBeta-Actin Rev CGTGAATGCCGCAGGATT 18
FSHR-1 L07302 oExon10 For CATTCACTGCCCACAACTTTCATC 24 84
oExon10 Rev TGAGTGTGTAATTGGAACCATTGGT 25
FSHR-2 NM_001009289 oExon10/11 For CAGGAACTTCCGCAGGGATT 20 72
oExon10/11 Rev TGATTGCAGATGAGCCCAACA 21
FSHR-3 L12767 oExon8/11 For CAGTAATTTGGAAGAACTGCCTAATG 26 80
oExon8/11 Rev AACAGTGCAGCAGTGGAGACA 21
LHR L36329 oLHR For AGATTGCTAAGAAAATGGCAGTCCTCT 28 82
oLHR Rev GCAGCTGAGATGGCAAAGAAAGAGA 25