Skip to main content

Table 1 Primer sequences

From: Corticotropin-releasing hormone stimulates expression of leptin, 11beta-HSD2 and syncytin-1 in primary human trophoblasts

  Forward (5´-3´) Reverse (5´-3´)
HPRT CCGGCTCCGTTATGGC GGTCATAACCTGGTTCATCATCA
r18S GCAATTATTCCCCATGAACG GGCCTCACTAAACCATCCAA
Leptin ACAATTGTCACCAGGATCAATGAC TCCAAACCGGTGACTTTCTGT
11β-HSD2 CATCACCGGCTGTGACTCTG CGGCAGCCGCATGTTAG
CRH-R1 alpha CTACATGCTGTTCTTCGTCAATCC GGCAGAACGGACCTGGAA
CRH-R2 TCCAGTACAGGAAGGCAGTGAA GGAGTTGAAATAGATGAACATGATCTG
Syncytin-1 ATGGAGCCCAAGATGCAG AGATCGTGGGCTAGCAG