Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 List of primers used for real-time PCR expression analysis of kiss and gnrh mRNAs

From: Increased expression of kisspeptin and GnRH forms in the brain of scombroid fish during final ovarian maturation and ovulation

Primer name Nucleotide sequences (5′-3′)
Mac. Kiss1 RT Fw CTACGACTCCTTGTTGCTTTG
Mac. Kiss1 RT Rv TGATCTTCACTGTAGTTGGTGG
Mac. Kiss2 RT Fw CTGAACAGAGGACACAAGGAAG
Mac. Kiss2 RT Rv CTCAGGCTGAAACAAAGGTTAG
Mac. RT sbGnRH Fw GCTGCTTCTTGGATCAGTAGTG
Mac. RT sbGnRH Rv AACCCCTCAACTACATCATCC
Mac. RT cGnRH-II Fw TGGGGTTGCTTCTATGTGTG
Mac. RT cGnRH-II Rv TCCTCTGAAATCTCTGGTGTG
Mac. RT sGnRH Fw ACTGGTCCTATGGATGGCTAC
Mac. RT sGnRH Rv TTCAGGAAGAGACACCACACC