Skip to main content

Table 1 Oligonucleotide sequences used in RT-PCR analysis

From: Developmental expression and function of DKKL1/Dkkl1 in humans and mice

Transcripts Annealing Temperature (°C) Product size (bp) Sequence direction (5’-3’)
DKKL1 58 299 Sense: TGCTGCTCCTCTCTACCCT
Antisense: CTCTCCTGTCTTGTTGTCGG
Dkkl1 55 217 Sense: TCGTGTCCTCCTCTGCTCTCT
Antisense: TTGCCCATTCTGTGCTCCT
β-actin 55 281 Sense: AACAGTCCGCCTAGAAGCAC
Antisense: CGTTGACATCCGTAAAGACC
GAPDH 58 100 Sense: GCTCTCTGCTCCTCCTGTTC
Antisense: GACTCCGACCTTCACCTTCC