Skip to main content

Table 1 Primers used for cDNA amplification of the targets by RT-PCR

From: Effect of tocopherol supplementation during last trimester of pregnancy on mRNA abundances of interleukins and angiogenesis in ovine placenta and uterus

Gene Primer Seq 5' to 3' Product length Accession number
IL-1b Forward TCACAGGAAATGAGCCGAGAA 150 NM_001009465
  Reverse CAGCTGCAGGGTCGGTGTAT   
IL-6 Forward ACACCACCCCAAGCAGACTACT 200 NM_001009392
  Reverse CCCAGATTGGAAGCATCCAT   
IL-8 Forward GCCAGAAGAAACCTGACAAAAAG 220 NM_001009401
  Reverse GCAGTGTGGCCCACTCTCA   
VEGF Forward CCTCACCAAAGCCAGCACAT 150 AF071015.1
  Reverse CGTCTGCGGATCTTGTACAAAC   
KDR Forward GATGCTCGCCTCCCTTTGA 250 AF233076
  Reverse GATCCCCATGCCAGCAATC   
SFlt1 Forward GCCACGCCTGAAATCTACCA 150 AF233077
  Reverse GGCGTTGAGCGGAATGTAGT   
TNFα Forward GACCCTCCTCATCCCCTTCT 300 NM_001024860.1
  Reverse AGCCCACCCATGTCAAGTTC   
β-actin Forward CCAAGGCCAACCGTGAGA 86 NM_001009784.1
  Reverse AGCCTGGATGGCCACGT   
  1. Ovine Interleukin (IL)-1b, IL-6, IL-8, Vascular Endothelial Growth Factor (VEGF), Kinase insert Domain Receptor (KDR), soluble Fms-Like Tyrosine kniase-1 (sFlt1), Tumor Necrosis Factor (TNF) α and β-actin cDNA were amplified by RT-PCR from the uterus and placenta total RNA using the above set of primers