Table 1 Sequence-specific primers for G/C and C/A alleles and their PCR product sizes for positions −137 and −607 in the promoter of the IL-18 gene
From: Association of interleukin-18 gene polymorphism with body mass index in women
Sequence-specific Primers | Primer sequence | Product size (bp) |
|---|---|---|
G/C allele at position − 137 | ||
Common reverse primer | 5’–AGGAGGGCAAAATGCACTGG–3’ | |
forward primers 1 | 5’–CCCCAACTTTTACGGAAGAAAAG–3’ | 261 |
forward primers 2 | 5’–CCCCAACTTTTACGGAAGAAAAC–3’ | 261 |
Control forward primer | 5’–CCAATAGGACTGATTATTCCGCA–3’ | 446 |
C/A allele at position − 607 | ||
Common reverse primer | 5’–TAACCTCATTCAGGACTTCC–3’ | |
forward primers 1 | 5’–GTTGCAGAAAGTGTAAAAATTATTAC–3’ | 196 |
forward primers 2 | 5’–GTTGCAGAAAGTGTAAAAATTATTAA–3’ | 196 |
Control forward primer | 5’–CTTTGCTATCATTCCAGGAA–3’ | 301 |