Skip to main content

Advertisement

Table 1 Primer sequences used for quantitative real-time PCR

From: Resveratrol promotes expression of SIRT1 and StAR in rat ovarian granulosa cells: an implicative role of SIRT1 in the ovary

Gene Primers Primer Sequence Expected size in base pair
β-actin Sense CGAGTACAACCTTCTTGCAG 207
  Antisense TTCTGACCCATACCCACCAT  
Bax Sense GAATTGGCGATGAACTGGAC 157
  Antisense GCAAAGTAGAAAAGGGCAACC  
Bcl2 Sense AACATCGCTCTGTGGATGAC 150
  Antisense GAGCAGCGTCTTCAGAGACA  
DBC1 Sense TCTCCAAGTCTCGCCTGTG 158
  Antisense CTCTGTTGCCTCCAACCAGT  
FSH-R Sense ATGGCCCCCATTTCATTCTT 82
  Antisense ACTAGGAGAATCTTGGCCTTGGA  
LH-R Sense ATTGACACTCTGCTTAACTTTCCATCT 82
  Antisense TGGCCATGAGGTACTCATGATCT  
p450arom Sense TCCTCAGCAGAGAAACTGGAAGA 151
  Antisense CGTACAGAGTGACGGACATGGT  
SIRT1 Sense TGTTTCCTGTGGGATACCTGA 137
  Antisense TGAAGAATGGTCTTGGGTCTTT  
StAR Sense AGGAAAACAGAACTGAGGCTTAGAATA 93
  Antisense AAGGTTTCATAGATACCTGTCCCTTAAC