Skip to main content

Table 1 Primer sequences and the conditions of RT-PCR

From: Human amniotic epithelial cells differentiate into cells expressing germ cell specific markers when cultured in medium containing serum substitute supplement

Primer Sequence (5’ → 3’) Product size (bp) Annealing temperature (°C) Cycles
GAPDH FW- TGATGACATCAAGAAGGTGGTGAAG 230 57 30
  REV -TCCTTGGAGGCCATGTGGGCCAT    
C-KIT FW- TTGTGCACGACGATGTCTGA 296 57 30
  REV- AGTCCATACCTCCCTCTCTT    
DAZL FW- GAGTGGTCAAAGGAGCCAAA 144 57 30
  REV- AGGAGCCACCTCCCTGAG    
VASA FW- TCTTCACAAGCTCCCAATCC 165 57 30
  REV- TGAGAATACAAGGACAGGAGCT    
ZP3 FW- GCTTTGCCTTCTGACACCTC 127 57 30
  REV- CAGACACAGGGTGGGAGG    
DMC1 FW- AGCAGCAAAGTTCCATGAAG 300 56 30
  REV- TGAGCTCTCCTCTTCCCTTT    
SCP3 FWD-TGGAAAACACAACAAGATCA 344 56 30
  REV-GCTATCTCTTGCTGCTGAGT    
STRA8 FW-CCTCAAAGTGGCAGGTTCTGAA 126 56 30
  REV-TCCTCTAAGCTGCTTGCATGC