Skip to main content

Table 1 Primer sequences

From: Expression of the insulin-like growth factor (IGF) system and steroidogenic enzymes in canine testis tumors

Primer Size Sense Antisense
Aro 419 CCCACTTCAGGTTCCTCTGGATGG TGTTAGAGGTGTCCAGCATG
AR 598 CCGTGAGCGCAGCACCTCCCGGTG TGCTCTCCCGCTGCTGCTACCTTCTG
IGF-I 350 ATGTCCTCCTCGCATCTCTT TCCCTCTACTTGCGTTCTTC
IGF-II 450 TTGGCCTTCGCCTCGTGCTG GGACGGTGACGCTTGGCCTCTCTG
IGF-IR 437 AAATGTGCCCGAGCGTGTG TGCCCTTGAAGATGGTGCATC
Red 1 213 CTGAGGAATCTCCGAAAACC TCTAAGGTACCACCGGTGAT
Red 2 250 TCACTAGAGGGAGGCCTTTTC ACAAGCCACCTTGTGGAATC
IGFBP1 240 ATAACTCAGGAGCAGCTTCTGG TCTTGTTGCAGTTTGGCAG
IGFBP2 553 AACGGCGAGGAGCACTCTGA AGGCACCGGCTGGCTATGTT
IGFBP3 200 AGTGAGTCCGAGGAGGACC GACTCAGAGGAGAAGTTCTGGG
IGFBP4 513 CTGCGGTTGTTGTGCCACTTGC CAGCATTTGCCACGCTGTCCATC
IGFBP5 484 GCAGGACGAGGAGAAGCCGC TCCACGCACCAGCAGATGCC
  1. Aro = p450-aromatase enzyme, AR = androgen receptor, IGF = insulin-like growth factor, IR = receptor type I, Red 1 = type I 5α-reductase enzyme, Red 2 = type II 5 α reductase enzyme, IGFBP = binding protein.