Open Access

Erratum to: Evidence of inhibin/activin subunit betaC and betaE synthesis in normal human endometrial tissue

  • Ioannis Mylonas1, 2Email author,
  • Ansgar Bruning1, 2,
  • Naim Shabani1, 2,
  • Susanne Kunze1, 2 and
  • Markus S Kupka1, 2
Reproductive Biology and Endocrinology20119:1

DOI: 10.1186/1477-7827-9-1

Received: 22 December 2010

Accepted: 5 January 2011

Published: 5 January 2011

The original article was published in Reproductive Biology and Endocrinology 2010 8:143

Correction

We have previously demonstrated the expression of inhibin subunits in endometrial tissues and used β-actin primer pairs to perform a PCR analysis loading control [1]. However, instead of using the mentioned β-actin primer pairs from a commercial molecular biology supplier, we used the β-actin primer pair listed in Table 1. All depicted primer pairs in Table 1 were designed and established by our group, and synthesized by the supplier Biomers.net (Ulm, Germany).
Table 1

Primer sequences and length of amplification products

 

Forward primer (5' - 3')

Backward primer (5' - 3')

Length

Inhibin-α

CCGGCCATCCCAGCATACACGC

GAGTTGAGCGTCGGGCTCTC

359 bp

Inhibin-βA

TGCCCTTGCTTTGGCTGAGA

ACTTTGCCCACATGAAGCTTT

282 bp

Inhibin-βB

GGCGAGCGGCGACTCAACCTAGA

CGTGTGGAAGGAGGAGGCAGAGC

333 bp

Inhibin-βC

GCAGCCCGGGTGAGAGTTGG

ACTGCACCCACAGGCCTC

393 bp

Inhibin-βE

AGCCCTTCCTAGAGCTTAAG

GCTGCAGCCACAGGCC

404 bp

β-actin

GGAGAAGCTGTGCTACGTCG

CGCTCAGGAGGAGCAATGAT

366 bp

bp = base pairs

Notes

Authors’ Affiliations

(1)
Ludwig-Maximilians-University Munich, 1st Department of Obstetrics and Gynecology
(2)
Department of Obstetrics and Gynecology, Klinikum Neuperlach

References

  1. Mylonas I, Brüning A, Shabani N, Kunze S, Kupka MS: Evidence of inhibin/activin subunit betaC and betaE synthesis in normal human endometrial tissue. Reprod Biol Endocrinol. 2010, 19 (8): 143-10.1186/1477-7827-8-143.View ArticleGoogle Scholar

Copyright

© Mylonas et al; licensee BioMed Central Ltd. 2011

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Advertisement